Máme pripravené dopyty z Vašej kategórie
Teraz 0 € paušálny poplatok (platí do 3. 3. 2024)
Ďalších 120 dopytov pre Vašu firmu. Zanechajte nám Váš kontakt.

Dopyty z kategórie: Ostatné

    Nájdené 881 dopytov
Za posledný týždeň 4 dopytov
Za posledný mesiac 19 dopytov
Za posledný rok 274 dopytov

Magazín Mojedopyty.sk

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - základné organické chemikálie - montovacie médium do laboratória - Vectashield plus // 10 ml Lokalita: - okres Košice Termín pre podanie ponúk: - 01.03.2024 do 09:45 hod. Hodnota: - 652 €

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - anorganické chemikálie - oligonukleotidy - Oligonukleotidy podľa špecifikácie, škála syntézy 0,04 umol Lokalita: - okres Košice Termín pre podanie ponúk: - 29.02.2024 do 12:40 hod. Hodnota: - 51,90 €

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - rádioaktívna chemikália - Thymidine, [methyl-3H]- Lokalita: - okres Bratislava Termín pre podanie ponúk: - 27.02.2024 do 10:00 hod. Hodnota: - 2.000 € bez DPH

Podrobný popis: -predmetom verejnej zákazky sú reagencie pre biochemické analyzátory 2024 - ALB2, 300T, cobas c, Integra - ASTL, 500Tests, cobas c, Integra - FT4 G3 Elecsys cobas e 200, atď. Lokalita: - okres Veľký Krtíš Termín pre podanie ponúk: - 01.03.2024 do 10:00 hod. Hodnota: -...

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - chemikálie a špecializované chemické výrobky - acetylcholinesterase Assay Kit (Colorimetric)/ bal 200 testov - DreamTaq Green PCR Master Mix (2X), bal/1000 reakcií, atď. Lokalita: - okres Košice Termín pre podanie ponúk:...

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - kyselina citrónová potravinárska - hydroxid sodný, 100 % - hydrát vápenný balený Lokalita: - okres Trnava Termín pre podanie ponúk: - 27.02.2024 do 14:00 hod. Hodnota: - 2.925 € bez DPH

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - acetón p.a. - Constanal-Kyselina chlorovodíková 0,1M (0,1N) ((Constanal-Hydrochloricacid 0,1M (0,1N)), 1ks - glycerín, p.a. (Glycerol, for analysis), atď. Lokalita: - okres Košice Termín pre podanie ponúk: - 26.02.2024 d...

Hľadám: chémiu Popis: - potrebujem bromid ortuťný, dusičnan ortuťný a chlorid ortuťný Špecifikácia: - bromid ortuťný (Hg2Br2, mercurous bromide) - chlorid ortuťný (Hg2Cl2, mercurous chloride) Množstvo: - najprv vzorku cca 1,5 kg, potom by som odoberal cca 10 kg ročne Lokalita: - Pr...

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - kit fagocytárnej aktivity pre prietokovú cytometriu - E. coli-FITC (inaktivovaná suspenzia E.coli, značená FITC ), 1x 1 ml, určený na 100 testov - lyzačný roztok, 1x 60 ml, určený na prípravu 600 ml 1x lyzačného roztoku = 300 te...

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - kyselina citrónová potravinárska - hydroxid sodný, 100 % - hydrát vápenný balený Lokalita: - okres Trnava Termín pre podanie ponúk: - 20.02.2024 do 12:00 hod. Hodnota: - 2.925 € bez DPH

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - reagencie PCR, primery a diagnostické súpravy - HOT FIREPol® Blend Master Mix zmes Hot Start a proof-reading DNA polymeráz, Bez farbiva, 1 ml - oligonukleotid desalted 0,04 umol - CTGGATAAAATTTGGGTTGA, atď. Lokalita: - okres...

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - Tellurium dioxide, ≥99%, CAS Number: 7446-07-3, bal. 250 g - Tetraethyl orthosilicate, ≥99.0% (GC), CAS Number: 78-10-4, bal. 1 L - Y2O3 - Yttrium(III) oxide (Oxid ytritý) - 99.99% trace metals basis, CAS Number: 1314-36-9, 50...

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - Barium carbonate, 99+%, for analysis, bal. 500 g - kyselina fluorovodíková, 38-40%, p.a., bal. 1 L Lokalita: - okres Trenčín Termín pre podanie ponúk: - 08.02.2024 do 10:00 hod. Hodnota: - 289,80 € bez DPH

Podrobný popis: -predmetom verejnej zákazky je dodanie membránovej vývevy - membránová výveva jednokomorová KNF N810 FT18/IP44, 1 ks - bližšie informácie v prílohe Lokalita: - okres Košice Termín pre podanie ponúk: - 07.02.2024 do 14:20 hod. Hodnota: - 1.146,16 €

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - kyselina dusičná 53 - 55 % - bližšie informácie v prílohe Lokalita: - okres Trnava Termín pre podanie ponúk: - 07.02.2024 do 12:00 hod. Hodnota: - 911,20 € bez DPH

Podrobný popis: -predmetom verejnej zákazky je reagencie pre biochemické analyzátory 2024 - ALB2, 300T, cobas c, Integra - C4, 100Tests, cobas c, Integra - GLUC HK Gen.3, 800Tests, cobas c, Int., atď. Lokalita: - okres Veľký Krtíš Termín pre podanie ponúk: - 14.02.2024 do 10:00 hod. H...

Podrobný popis: -predmetom verejnej zákazky sú biochemické testy - Enterotest 24, obsahuje 40 testov v balení, Test s činidlami - EN-COCCUStest, obsahuje 36 testov v balení, atď. Lokalita: - okres Bratislava Termín pre podanie ponúk: - 07.02.2024 do 09:00 hod. Hodnota: - 946 € bez DPH

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - kvapalný dusík, 6.500 - 10.800 l Lokalita: - okres Trnava Termín pre podanie ponúk: - 05.02.2024 do 09:00 hod. Hodnota: - 20.412 € bez DPH

Hľadám: auto-moto Popis: - mám záujem o zmrazovací spray Objem: - 300-400 ml Množstvo: - 50 ks Lokalita: - Ružomberok Termín: - ihneď Doplňujúce informácie: - násadka min 14 cm - viď príloha

Podrobný popis: -predmetom verejnej zákazky je dodanie chemikálií - 4-Aminofenol pre syntézu, 98%-99%, 1.000 g Lokalita: - okres Bratislava Termín pre podanie ponúk: - 30.01.2024 do 10:00 hod. Hodnota: - 86,55 € bez DPH

Kontakty

Business Aggregator, s.r.o.
Sluneční náměstí 2583/11, Praha 13
IČO: 08320349

O projekte

Projekt MojeDopyty.sk združuje 145 647 dopytov na jednom mieste. Využíva spoluprácu s najvýznamnejšími zdrojmi obchodných príležitostí v SR a zaisťuje tak podiel presahujúci 70 % všetkých dopytov a verejných zákaziek dostupných na slovenskom internete. Táto služba predstavuje moderný spôsob ako získavať nových zákazníkov s revolučným konceptom platby za realizáciu zákazky.

MojeDopyty.sk © 2024 | všetky práva vyhradené